Length: 5719 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
689 bp |
Genome contig ID |
gi51511727f_107499044 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- GGCCTCCATGACAGAGTGAGACCCTGTTTCCATTT |
Flanking genome sequence (113429 - 113478) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAGTGAAAGCAAGAGAGTTGAAAGTTCAAAGGGGCG |
Length: 169 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92370 |
8.4e-70 |
100.0 |
ataxia telangie...
|
Homo sapiens
|
EAW67112 |
4.6e-68 |
98.8 |
ataxia telangie...
|
Homo sapiens
|
EAW67109 |
1.1e-67 |
98.8 |
ataxia telangie...
|
Homo sapiens
|
EAW67114 |
1.4e-67 |
98.8 |
ataxia telangie...
|
Homo sapiens
|
AAO26044 |
1.5e-67 |
98.8 |
ataxia telangie...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.