Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07574
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209133
Product ID ORK07574
Clone name fg02508
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ATM
cDNA sequence DNA sequence (5719 bp)
Predicted protein sequence (169 aa)
Description Homo sapiens mRNA for ataxia telangiectasia mutated protein isoform 1 variant protein.
Features of the cloned cDNA sequence

Length: 5719 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 689 bp
Genome contig ID gi51511727f_107499044
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGCCTCCATGACAGAGTGAGACCCTGTTTCCATTT
Flanking genome sequence
(113429 - 113478)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGTGAAAGCAAGAGAGTTGAAAGTTCAAAGGGGCG

Features of the protein sequence

Length: 169 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92370 8.4e-70 100.0 ataxia telangie...
Homo sapiens
EAW67112 4.6e-68 98.8 ataxia telangie...
Homo sapiens
EAW67109 1.1e-67 98.8 ataxia telangie...
Homo sapiens
EAW67114 1.4e-67 98.8 ataxia telangie...
Homo sapiens
AAO26044 1.5e-67 98.8 ataxia telangie...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp