ORK07576

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07576

Order Kazusa clone(s) from :

Accession No	AB209145
Product ID	ORK07576
Clone name	fg06182
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RASSF5
cDNA sequence	DNA sequence (5586 bp) Predicted protein sequence (352 aa)
Description	Homo sapiens mRNA for Ras association (RalGDS/AF-6) domain family 5 isoform B variant protein.

Features of the cloned cDNA sequence

Description

Length: 5586 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4525 bp
Genome contig ID	gi89161185f_204647551
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTAAAAAAAAGTAATAAAAGCCTGTTGCAAAAATG
Flanking genome sequence (181680 - 181729)	----+--------+--------+--------+--------+----* ACTCATGTTAGAAACGTCTCCCTTGAACTTCACCATCTTACGGACACTGG

Features of the protein sequence

Description

Length: 352 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92382	2.4e-113	100.0	Ras association...	Homo sapiens
XP_001086936	3.8e-108	96.2	similar to Ras ...	Macaca mulatta
AAL40389	3.5e-105	100.0	putative tumor ...	Homo sapiens
EAW93543	3.8e-105	100.0	Ras association...	Homo sapiens
CAI15254	3.9e-105	100.0	Ras association...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	125	175	PF00130	Protein kinase C
HMMPfam	IPR000159	276	334	PF00788	Ras-association
HMMSmart	IPR002219	125	172	SM00109	Protein kinase C
HMMSmart	IPR000159	274	351	SM00314	Ras-association
ProfileScan	IPR002219	124	172	PS50081	Protein kinase C
ProfileScan	IPR000159	276	352	PS50200	Ras-association
ScanRegExp	IPR002219	125	172	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp