Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07579
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210010
Product ID ORK07579
Clone name fh12484
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SYMPK
cDNA sequence DNA sequence (5455 bp)
Predicted protein sequence (1073 aa)
Description symplekin
Features of the cloned cDNA sequence

Length: 5455 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2188 bp
Genome contig ID gi42406306r_50914011
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGCTCTTCTGGCTCAATAAAGACTTCCTGGTTGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCACATGGCAAGTGGTGTTTGGGGAAGGGCTTCAAAGGCAGCTCCTGG

Features of the protein sequence

Length: 1073 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06092 0 100.0 SYMPK variant p...
Homo sapiens
XP_001166996 0 99.6 symplekin isofo...
Pan troglodytes
XP_512762 0 99.6 symplekin isofo...
Pan troglodytes
XP_001167111 0 99.6 symplekin isofo...
Pan troglodytes
Q92797 0 99.6 Symplekin.
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 120 155 PF02985 HEAT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp