Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07586
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226099
Product ID ORK07586
Clone name fh21196
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CHORDC1
cDNA sequence DNA sequence (5367 bp)
Predicted protein sequence (196 aa)
Description cysteine and histidine-rich domain (CHORD)-containing, zinc binding protein 1
Features of the cloned cDNA sequence

Length: 5367 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 956 bp
Genome contig ID gi51511727r_89474265
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACTATTACATGTTAAATAAAAATAGCTTAATTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTGGAGTTTTTTTTTAAAGTCATGAAGAGCTTCACAATTCTAGTGATACA

Features of the protein sequence

Length: 196 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAG43237 1.3e-85 100.0 chymotrypsin-li...
Homo sapiens
XP_522142 1.3e-85 100.0 cysteine and hi...
Pan troglodytes
XP_001138405 1.4e-85 100.0 cysteine and hi...
Pan troglodytes
EAW66870 1.4e-85 100.0 cysteine and hi...
Homo sapiens
EAW66867 3.2e-85 99.4 cysteine and hi...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007051 17 81 PF04968 CHORD
IPR007052 94 170 PF04969 CS
ProfileScan IPR007052 91 180 PS51203 CS
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp