Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07620
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209551
Product ID ORK07620
Clone name fk12694
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SPTBN1
cDNA sequence DNA sequence (3100 bp)
Predicted protein sequence (75 aa)
Description Homo sapiens mRNA for spectrin, beta, non-erythrocytic 1 isoform 1 variant protein.
Features of the cloned cDNA sequence

Length: 3100 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2092 bp
Genome contig ID gi89161199f_54506241
PolyA signal sequence
(AGTAAA,-8)
+----*----+----*----+----*----+----
TGCAGTGTATACTCTTTTTCAGTATTCAGTAAAGT
Flanking genome sequence
(103101 - 103150)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGATGTAAAGCTCATTGGCAGAGAGCATTGCTAGT

Features of the protein sequence

Length: 75 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92788 7.4e-30 100.0 spectrin, beta,...
Homo sapiens
EAX00137 1.6e-23 100.0 spectrin, beta,...
Homo sapiens
BAD92985 1.3e-22 98.4 spectrin, beta,...
Homo sapiens
AAH92544 1.1e-17 98.0 Spnb2 protein [...
Mus musculus
AAX93104 2.9e-17 100.0 unknown [Homo s...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp