Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07655
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290170
Product ID ORK07655
Clone name hh04442y2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DNAH17
cDNA sequence DNA sequence (4423 bp)
Predicted protein sequence (1404 aa)
Description Homo sapiens mRNA for DNAH17 variant protein
Features of the cloned cDNA sequence

Length: 4423 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 208 bp
Genome contig ID gi51511734r_73831374
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
AGAGGTGGGGCAGATTAAAGCCAGTGGAGCCACTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCTGTGCCCATCCATTCTGTGCCTGATGGCCACTGTGAGGCCTGGTTCA

Features of the protein sequence

Length: 1404 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG06724 0 100.0 DNAH17 variant ...
Homo sapiens
XP_533129 0 96.1 similar to dyne...
Canis lupus fam...
XP_001106086 0 94.6 similar to dyne...
Macaca mulatta
EAW89528 0 100.0 hCG1813078, iso...
Homo sapiens
CAB59252 0 100.0 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004273 700 1403 PF03028 Dynein heavy chain
ScanRegExp IPR001680 344 358 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp