ORK07656

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07656

Order Kazusa clone(s) from :

Accession No	AB210029
Product ID	ORK07656
Clone name	hh05223
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KIF1A
cDNA sequence	DNA sequence (5609 bp) Predicted protein sequence (1478 aa)
Description

Features of the cloned cDNA sequence

Description

Length: 5609 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	943 bp
Genome contig ID	gi89161199r_241201858
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CCAATTAAGAAATAAATGTGGCTCTTACTCAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCCCATGGGCTCTGCTGTGGCTTTATTTGCGTGTTACGTGTGTTGCAG

Features of the protein sequence

Description

Length: 1478 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06111	100.0	KIF1A variant p...	Homo sapiens
BAG06726	99.3	KIF1A variant p...	Homo sapiens
AAR04821	91.9	kinesin-related...	Mus musculus
BAE02545	73.0	kinesin family ...	Homo sapiens
XP_695144	79.8	similar to kine...	Danio rerio

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	94	115	PR00380	Kinesin
	IPR001752	214	231	PR00380	Kinesin
	IPR001752	249	267	PR00380	Kinesin
	IPR001752	310	331	PR00380	Kinesin
HMMPfam	IPR001752	17	361	PF00225	Kinesin
HMMPfam	IPR000253	531	602	PF00498	Forkhead-associated
HMMSmart	IPR001752	9	368	SM00129	Kinesin
HMMSmart	IPR000253	530	587	SM00240	Forkhead-associated
ProfileScan	IPR001752	8	279	PS50067	Kinesin
ProfileScan	IPR000253	531	587	PS50006	Forkhead-associated
ScanRegExp	IPR001752	248	259	PS00411	Kinesin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp