ORK07664

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07664

Order Kazusa clone(s) from :

Accession No	AB209065
Product ID	ORK07664
Clone name	hk00560
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ILVBL
cDNA sequence	DNA sequence (4248 bp) Predicted protein sequence (427 aa)
Description	ilvB (bacterial acetolactate synthase)-like

Features of the cloned cDNA sequence

Description

Length: 4248 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2536 bp
Genome contig ID	gi42406306r_14986795
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAACCACCTCTGGCCCATGTAGGCCCAAGTACTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCTCAGAACCTGTGCATATTTATTTATTATCCACAAAGATGGAGGTGC

Features of the protein sequence

Description

Length: 427 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92302	2.3e-167	100.0	ilvB (bacterial...	Homo sapiens
XP_512449	8.9e-72	89.9	ilvB (bacterial...	Pan troglodytes
AAC50934	9e-72	91.6	acetolactate sy...	Homo sapiens
A1L0T0	9e-72	91.8	Acetolactate sy...	Homo sapiens
XP_001172051	9.2e-72	91.3	ilvB (bacterial...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012001	17	167	PF02776	Thiamine pyrophosphate enzyme
HMMPfam	IPR012000	267	374	PF00205	Thiamine pyrophosphate enzyme

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp