Length: 7809 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
5123 bp |
Genome contig ID |
gi51511731r_68028411 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- TTTTTTTTTAATTTGAATAAAAAGAATTAGAAGTG |
Flanking genome sequence (99959 - 99910) |
----+----*----+----*----+----*----+----*----+----* ATGTCCTTTTATAAAATGCCTTCTCCCCCTTCCCGCCTACAGTCTCTTCC |
Length: 210 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92909 |
6.4e-92 |
100.0 |
Transducin-like...
|
Homo sapiens
|
BAG50879 |
7.1e-31 |
98.8 |
unnamed protein...
|
Homo sapiens
|
BAG65275 |
7.3e-31 |
98.8 |
unnamed protein...
|
Homo sapiens
|
AAH06672 |
7.5e-31 |
98.8 |
Tle3 protein [M...
|
Mus musculus
|
AAH97419 |
8.6e-31 |
92.3 |
Tle3 protein [R...
|
Rattus norvegicus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.