Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07684
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209672
Product ID ORK07684
Clone name pf03743
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TLE3
cDNA sequence DNA sequence (7809 bp)
Predicted protein sequence (210 aa)
Description Homo sapiens mRNA for Transducin-like enhancer of split 3 splice variant 1 variant protein.
Features of the cloned cDNA sequence

Length: 7809 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5123 bp
Genome contig ID gi51511731r_68028411
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTTTTTTTAATTTGAATAAAAAGAATTAGAAGTG
Flanking genome sequence
(99959 - 99910)
----+----*----+----*----+----*----+----*----+----*
ATGTCCTTTTATAAAATGCCTTCTCCCCCTTCCCGCCTACAGTCTCTTCC

Features of the protein sequence

Length: 210 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92909 6.4e-92 100.0 Transducin-like...
Homo sapiens
BAG50879 7.1e-31 98.8 unnamed protein...
Homo sapiens
BAG65275 7.3e-31 98.8 unnamed protein...
Homo sapiens
AAH06672 7.5e-31 98.8 Tle3 protein [M...
Mus musculus
AAH97419 8.6e-31 92.3 Tle3 protein [R...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp