ORK07686

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07686

Order Kazusa clone(s) from :

Accession No	AB209690
Product ID	ORK07686
Clone name	pf06453
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADAM32
cDNA sequence	DNA sequence (6873 bp) Predicted protein sequence (279 aa)
Description	Homo sapiens mRNA for ADAM 32 precursor (A disintegrin and metalloprotease domain 32) variant protein.

Features of the cloned cDNA sequence

Description

Length: 6873 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	6008 bp
Genome contig ID	gi51511724f_38994798
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAGAACACAAATAAAACTCTGACTTTCATTCCATC
Flanking genome sequence (206035 - 206084)	----+--------+--------+--------+--------+----* AGATTGTGCTATACTTTTTCAATCAAATAGACACTGGTTGTTTCCAAATC

Features of the protein sequence

Description

Length: 279 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92927	3.1e-119	100.0	ADAM 32 precurs...	Homo sapiens
BAG61934	8.1e-96	97.8	unnamed protein...	Homo sapiens
AAO45696	1.7e-95	99.5	metalloproteina...	Homo sapiens
EAW63282	1.7e-95	99.5	ADAM metallopep...	Homo sapiens
Q8TC27	2e-95	99.5	Disintegrin and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002870	48	145	PF01562	Peptidase M12B
HMMPfam	IPR001590	188	279	PF01421	Peptidase M12B
ProfileScan	IPR001590	187	279	PS50215	Peptidase M12B

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp