Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07689
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209419
Product ID ORK07689
Clone name pg00376
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HDAC10
cDNA sequence DNA sequence (5985 bp)
Predicted protein sequence (392 aa)
Description Homo sapiens mRNA for histone deacetylase 10 variant protein.
Features of the cloned cDNA sequence

Length: 5985 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 125 bp
Genome contig ID gi89161203r_48926231
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACACCGCAGAAATGACACCGCACGCCAGCGCCCC
Flanking genome sequence
(99775 - 99726)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCGATCCGGACCCCAAGCCCACGGCTCCCTCGACTCTGGGGCAC

Features of the protein sequence

Length: 392 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92656 3.9e-137 100.0 histone deacety...
Homo sapiens
Q969S8 7.5e-133 99.2 Histone deacety...
Homo sapiens
AAK92205 1.4e-132 98.9 histone deacety...
Homo sapiens
EAW73515 7.5e-132 98.2 histone deacety...
Homo sapiens
EAW73514 1.1e-131 98.9 histone deacety...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000286 8 99 PF00850 Histone deacetylase superfamily
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp