Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07690
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290161
Product ID ORK07690
Clone name pg00641y1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIF26A
cDNA sequence DNA sequence (6723 bp)
Predicted protein sequence (1869 aa)
Description Homo sapiens mRNA for KIF26A/KIAA1236 variant protein
Features of the cloned cDNA sequence

Length: 6723 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1104 bp
Genome contig ID gi51511730f_103575130
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GCTTTTATTTGTGAATTAAAGATGCATCGATGGTT
Flanking genome sequence
(141856 - 141905)
----+----*----+----*----+----*----+----*----+----*
CCCACGGCTGCCGAGTTCACTGGGCGTCGGCAGACTCCTCACGCCCTGGT

Features of the protein sequence

Length: 1869 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG06715 0 100.0 KIF26A variant ...
Homo sapiens
Q9ULI4 0 100.0 Kinesin-like pr...
Homo sapiens
EAW81861 0 100.0 hCG22909, isofo...
Homo sapiens
EAW81860 0 99.9 hCG22909, isofo...
Homo sapiens
Q52KG5 0 77.7 Kinesin-like pr...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001752 447 468 PR00380 Kinesin
IPR001752 616 634 PR00380 Kinesin
IPR001752 661 682 PR00380 Kinesin
HMMPfam IPR001752 364 713 PF00225 Kinesin
HMMSmart IPR001752 356 720 SM00129 Kinesin
ProfileScan IPR001752 355 637 PS50067 Kinesin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp