Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07703
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209575
Product ID ORK07703
Clone name sj01267
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GPI
cDNA sequence DNA sequence (4648 bp)
Predicted protein sequence (520 aa)
Description Homo sapiens mRNA for glucose phosphate isomerase variant protein.
Features of the cloned cDNA sequence

Length: 4648 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3059 bp
Genome contig ID gi42406306f_39447979
PolyA signal sequence
(ACTAAA,-20)
+----*----+----*----+----*----+----
TGAAACGCCGTCTGTACTAAAAAAACAAAAAAAGG
Flanking genome sequence
(105339 - 105388)
----+----*----+----*----+----*----+----*----+----*
TTACCTGGGCGGGCATGGTGGCGAGCACCTGTAATATCAGCTACTGGGGA

Features of the protein sequence

Length: 520 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92812 4.4e-191 100.0 glucose phospha...
Homo sapiens
BAG56947 6.4e-10 85.0 unnamed protein...
Homo sapiens
1IAT 6.7e-10 85.0 PHOSPHOGLUCOSE ...
Homo sapiens
1JLH 6.7e-10 85.0 phosphoglucose ...
Homo sapiens
P06744 6.7e-10 85.0 Glucose-6-phosp...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001672 375 415 PF00342 Phosphoglucose isomerase (PGI)
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp