Length: 4648 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
3059 bp |
Genome contig ID |
gi42406306f_39447979 |
PolyA signal sequence (ACTAAA,-20) |
+----*----+----*----+----*----+---- TGAAACGCCGTCTGTACTAAAAAAACAAAAAAAGG |
Flanking genome sequence (105339 - 105388) |
----+----*----+----*----+----*----+----*----+----* TTACCTGGGCGGGCATGGTGGCGAGCACCTGTAATATCAGCTACTGGGGA |
Length: 520 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92812 |
4.4e-191 |
100.0 |
glucose phospha...
|
Homo sapiens
|
BAG56947 |
6.4e-10 |
85.0 |
unnamed protein...
|
Homo sapiens
|
1IAT |
6.7e-10 |
85.0 |
PHOSPHOGLUCOSE ...
|
Homo sapiens
|
1JLH |
6.7e-10 |
85.0 |
phosphoglucose ...
|
Homo sapiens
|
P06744 |
6.7e-10 |
85.0 |
Glucose-6-phosp...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR001672 |
375 |
415 |
PF00342 |
Phosphoglucose isomerase (PGI) |