Length: 4637 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
1087 bp |
| Genome contig ID |
gi51511732r_82668961 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- GAGACATTTATGATTAAACCATTTATGCTACATAT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AACTGGGGAAAACTATGATGCTTTCGGTGCTGGGAATGCAGTGAGGTCCC |
Length: 456 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92831 |
2.3e-157 |
100.0 |
TBP-associated ...
|
Homo sapiens
|
| NP_005670 |
4.7e-140 |
92.6 |
TATA box-bindin...
|
Homo sapiens
|
| Q15572 |
4.7e-140 |
92.6 |
TATA box-bindin...
|
Homo sapiens
|
| EAW95495 |
5.9e-140 |
92.4 |
TATA box bindin...
|
Homo sapiens
|
| EAW95499 |
6e-140 |
92.4 |
TATA box bindin...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.