Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07708
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209594
Product ID ORK07708
Clone name sj05705
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TAF1C
cDNA sequence DNA sequence (4637 bp)
Predicted protein sequence (456 aa)
Description adenosine deaminase domain containing 2
Features of the cloned cDNA sequence

Length: 4637 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1087 bp
Genome contig ID gi51511732r_82668961
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GAGACATTTATGATTAAACCATTTATGCTACATAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTGGGGAAAACTATGATGCTTTCGGTGCTGGGAATGCAGTGAGGTCCC

Features of the protein sequence

Length: 456 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92831 2.3e-157 100.0 TBP-associated ...
Homo sapiens
NP_005670 4.7e-140 92.6 TATA box-bindin...
Homo sapiens
Q15572 4.7e-140 92.6 TATA box-bindin...
Homo sapiens
EAW95495 5.9e-140 92.4 TATA box bindin...
Homo sapiens
EAW95499 6e-140 92.4 TATA box bindin...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp