ORK07713

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07713

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07713
Clone name	fg03009
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CXCL12
cDNA sequence	DNA sequence (6196 bp) Predicted protein sequence (157 aa)
HaloTag ORF Clone	FHC07713
Flexi ORF Clone	FXC07713
Description	chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)

Features of the cloned cDNA sequence

Description

Length: 6196 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5720 bp
Genome contig ID	gi89161187r_44085620
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TATAATTTTCCTAATAAAGTTCTGTACTCAAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCACCAACAGTTTGAAATTAGTGTTACTACTTGGAATTTTCTGGACGT

Features of the protein sequence

Description

Length: 157 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11056	3.1e-52	100.0	stromal cell-de...	synthetic construct
EDK99573	2.1e-39	82.0	chemokine (C-X-...	Mus musculus
AAT76437	7.2e-37	87.2	stromal cell-de...	Homo sapiens
NP_001012495	2.8e-35	82.2	stromal cell-de...	Mus musculus
XP_001489694	4.5e-35	82.2	similar to stro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001811	42	107	PF00048	Small chemokine
HMMSmart	IPR001811	47	106	SM00199	Small chemokine

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	19	RAMNAKVVVVLVLVLTALCLSD	40	PRIMARY	22