ORK07718

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07718

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07718
Clone name	ha01927s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAP7
cDNA sequence	DNA sequence (4361 bp) Predicted protein sequence (883 aa)
HaloTag ORF Clone	FHC07718
Flexi ORF Clone	FXC07718
Description	microtubule-associated protein 7

Features of the cloned cDNA sequence

Description

Length: 4361 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1494 bp
Genome contig ID	gi89161210r_136605566
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CATGAAACACCAAATAAAATGTTTGACATAGTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTAGCTTTCTCATATGTTATAACTTCACTCAGATTGATTCTTGAGT

Features of the protein sequence

Description

Length: 883 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14244	4.1e-171	100.0	Ensconsin; Micr...	Homo sapiens
BAG10550	5.3e-171	99.8	microtubule-ass...	synthetic construct
AAH25777	9.6e-171	99.8	MAP7 protein [H...	Homo sapiens
BAG35651	2.2e-170	99.7	unnamed protein...	Homo sapiens
BAH12386	2.2e-165	98.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008604	590	760	PF05672	E-MAP-115

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp