Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07721
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07721
Clone name ef00515s1
Vector information
The cDNA fragment was cloned at XhoI-SacI site of the
Symbol NCOR2
cDNA sequence DNA sequence (8675 bp)
Predicted protein sequence (2468 aa)
Flexi ORF Clone FXC07721
Description nuclear receptor co-repressor 2
Features of the cloned cDNA sequence

Length: 8675 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 990 bp
Genome contig ID gi89161190r_123274915
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ACACGTCGTTCTAATTAAAAAGCGAATTATACTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTACAAAGGTTTCTTCTCTACCTCAGACTGGGCAGCCAATAGGGCAGG

Features of the protein sequence

Length: 2468 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG72661 0 100.0 nuclear recepto...
synthetic construct
Q9Y618 0 96.9 Nuclear recepto...
Homo sapiens
NP_006303 0 96.9 nuclear recepto...
Homo sapiens
EAW98448 0 98.4 nuclear recepto...
Homo sapiens
EAW98451 0 96.6 nuclear recepto...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014778 447 492 PF00249 Myb
IPR014778 630 675 PF00249 Myb
HMMSmart IPR001005 446 494 SM00717 SANT
IPR001005 629 677 SM00717 SANT
ProfileScan IPR001005 631 675 PS50090 SANT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp