Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07759
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07759
Clone name fh21703
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GATAD2B
cDNA sequence DNA sequence (5575 bp)
Predicted protein sequence (606 aa)
Flexi ORF Clone FXC07759
Description GATA zinc finger domain containing 2B
Features of the cloned cDNA sequence

Length: 5575 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3550 bp
Genome contig ID gi89161185r_151945727
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTGATCCATTTAAAAGGAATTGTACATTGTGTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAACCTGAAAAAGAGAAAAAAAAGCCCTAGCCATGGATAT

Features of the protein sequence

Length: 606 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8WXI9 1.5e-201 100.0 Transcriptional...
Homo sapiens
XP_001144374 2.1e-201 99.8 GATA zinc finge...
Pan troglodytes
BAG52906 5.8e-201 99.6 unnamed protein...
Homo sapiens
XP_001929553 6.5e-201 99.6 GATA zinc finge...
Sus scrofa
XP_001111874 2e-200 99.6 similar to GATA...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000679 433 467 PF00320 Zinc finger
ProfileScan IPR000679 427 457 PS50114 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp