ORK07762

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07762

Order Kazusa clone(s) from :

Accession No
Product ID	ORK07762
Clone name	bm06379
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DEAF1
cDNA sequence	DNA sequence (1999 bp) Predicted protein sequence (559 aa)
HaloTag ORF Clone	FHC07762
Flexi ORF Clone	FXC07762
Description	deformed epidermal autoregulatory factor 1 (Drosophila)

Features of the cloned cDNA sequence

Description

Length: 1999 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	317 bp
Genome contig ID	gi51511727r_534233
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CGTGTTGTGTCTGTCAATAAAGTGTAAATAAGGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCTGCCCCACACGGCCGGTTGCAGTGCCAGCCCTCGGGGGGGGGTTTC

Features of the protein sequence

Description

Length: 559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75398	3.2e-190	100.0	Deformed epider...	Homo sapiens
O77562	9.1e-189	99.1	Deformed epider...	Pan troglodytes
AAC79677	2.9e-184	98.7	nuclear DEAF-1 ...	Homo sapiens
XP_540529	9e-179	93.2	similar to defo...	Canis lupus fam...
EDM12021	2.4e-178	93.7	deformed epider...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000770	187	267	PF01342	SAND
HMMPfam	IPR002893	498	534	PF01753	Zinc finger
HMMSmart	IPR000770	195	267	SM00258	SAND
ProfileScan	IPR000770	187	267	PS50864	SAND
ProfileScan	IPR002893	498	534	PS50865	Zinc finger
ScanRegExp	IPR002893	498	534	PS01360	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	LAEAAAVAAAAAVAAAAAAAAGG	29	PRIMARY	23