Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07770
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07770
Clone name bm02123
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SIRT2
cDNA sequence DNA sequence (1802 bp)
Predicted protein sequence (396 aa)
Flexi ORF Clone FXC07770
Description sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)
Features of the cloned cDNA sequence

Length: 1802 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 593 bp
Genome contig ID gi42406306r_43961042
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TTATTGGAGACAAATTAAAAACAAAAACAACTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCCGGTCTGGCCTCCTGTTTCTTTCTGTGGGCACCCAGGGAAATCTCT

Features of the protein sequence

Length: 396 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8IXJ6 6.1e-157 99.1 NAD-dependent d...
Homo sapiens
Q4R834 6.9e-155 97.5 NAD-dependent d...
Macaca fascicularis
EAW56836 9.3e-155 98.3 sirtuin (silent...
Homo sapiens
Q5RBF1 1.1e-149 100.0 NAD-dependent d...
Pongo abelii
EAW56834 1.7e-148 99.7 sirtuin (silent...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003000 91 275 PF02146 Silent information regulator protein Sir2
ProfileScan IPR003000 72 347 PS50305 Silent information regulator protein Sir2
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp