ORK08544

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK08544

Order Kazusa clone(s) from :

Accession No
Product ID	ORK08544
Clone name	bm03620
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PHGDH
cDNA sequence	DNA sequence (1826 bp) Predicted protein sequence (546 aa)
HaloTag ORF Clone	FHC08544
Flexi ORF Clone	FXC08544
Description	phosphoglycerate dehydrogenase

Features of the cloned cDNA sequence

Description

Length: 1826 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	185 bp
Genome contig ID	gi89161185f_119956130
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- CGTCTAATAAAGAGCCTACCCCCAACTCCTTCTGC
Flanking genome sequence (132243 - 132292)	----+--------+--------+--------+--------+----* ACTTTTGTGTGGTCATTATCCTAAAGCGCCACCAGAGGGCGTCCAAAGGC

Features of the protein sequence

Description

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43175	100.0	D-3-phosphoglyc...	Homo sapiens
AAD51415	99.8	3-phosphoglycer...	Homo sapiens
A5A6P1	99.4	D-3-phosphoglyc...	Pan troglodytes
Q60HD7	99.0	D-3-phosphoglyc...	Macaca fascicularis
Q5R7M2	99.0	D-3-phosphoglyc...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006139	22	330	PF00389	D-isomer specific 2-hydroxyacid dehydrogenase
HMMPfam	IPR006140	124	298	PF02826	D-isomer specific 2-hydroxyacid dehydrogenase
HMMTigr	IPR006236	21	546	TIGR01327	D-3-phosphoglycerate dehydrogenase
ScanRegExp	IPR006140	161	188	PS00065	D-isomer specific 2-hydroxyacid dehydrogenase
	IPR006140	209	231	PS00670	D-isomer specific 2-hydroxyacid dehydrogenase
	IPR006140	238	254	PS00671	D-isomer specific 2-hydroxyacid dehydrogenase
	IPR001588	434	441	PS00306	Casein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp