ORK09144

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK09144

Order Kazusa clone(s) from :

Accession No
Product ID	ORK09144
Clone name	fk10322
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ME1
cDNA sequence	DNA sequence (3320 bp) Predicted protein sequence (607 aa)
HaloTag ORF Clone	FHC09144
Flexi ORF Clone	FXC09144
Description	malic enzyme 1, NADP(+)-dependent, cytosolic

Features of the cloned cDNA sequence

Description

Length: 3320 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1495 bp
Genome contig ID	gi89161210r_83876867
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CTATGCAAAAGATTTATTAAAGCATAGAAAAGGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGAATAAAAATATAAAATAATTGTCCTTTTTCTTAAAATGTTACATTG

Features of the protein sequence

Description

Length: 607 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P48163	100.0	NADP-dependent ...	Homo sapiens
BAF82472	99.8	unnamed protein...	Homo sapiens
BAD97137	99.8	cytosolic malic...	Homo sapiens
AAC50613	99.8	cytosolic NADP(...	Homo sapiens
AAB01380	96.6	NADP-dependent ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001891	120	144	PR00072	Malic oxidoreductase
	IPR001891	180	209	PR00072	Malic oxidoreductase
	IPR001891	216	238	PR00072	Malic oxidoreductase
	IPR001891	276	294	PR00072	Malic oxidoreductase
	IPR001891	301	317	PR00072	Malic oxidoreductase
	IPR001891	332	348	PR00072	Malic oxidoreductase
	IPR001891	433	449	PR00072	Malic oxidoreductase
HMMPfam	IPR012301	114	303	PF00390	Malic enzyme
HMMPfam	IPR012302	305	557	PF03949	Malic enzyme
ScanRegExp	IPR015884	301	317	PS00331	Malic enzyme

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp