Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK09681
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK09681
Clone name hm00157
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol USP7
cDNA sequence DNA sequence (4046 bp)
Predicted protein sequence (1060 aa)
Description Ubiquitin carboxyl-terminal hydrolase 7
Features of the cloned cDNA sequence

Length: 4046 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 862 bp
Genome contig ID gi51511732r_8794494
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTGGTTAGTAAGCTGTCGACTTTGTAAAAAAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATGAAAAAAAAAGGAAAAATGAATTGTATATTTAATGAATGAACAT

Features of the protein sequence

Length: 1060 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAH13801 0 100.0 unnamed protein...
Homo sapiens
Q93009 0 100.0 Ubiquitin carbo...
Homo sapiens
XP_510806 0 99.9 ubiquitin speci...
Pan troglodytes
CAA96580 0 99.9 herpesvirus ass...
Homo sapiens
BAH14812 0 99.8 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002083 33 155 PF00917 MATH
IPR001394 169 476 PF00443 Peptidase C19
HMMSmart IPR002083 28 134 SM00061 MATH
ProfileScan IPR002083 26 153 PS50144 MATH
IPR001394 172 480 PS50235 Peptidase C19
ScanRegExp IPR001394 173 188 PS00972 Peptidase C19
IPR001394 406 423 PS00973 Peptidase C19
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp