Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK09744
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK09744
Clone name bm02122
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CIRBP
cDNA sequence DNA sequence (1821 bp)
Predicted protein sequence (208 aa)
Flexi ORF Clone FXC09744
Description cold inducible RNA binding protein
Features of the cloned cDNA sequence

Length: 1821 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 726 bp
Genome contig ID gi42406306f_1117722
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GCTTTACGAAGCCGATTAAAAGACCGTGTGAAATG
Flanking genome sequence
(106449 - 106498)
----+----*----+----*----+----*----+----*----+----*
AACCTTGCTCTGACAATTCCCTTGCATTGCACCACACACTCCTTGCTGCG

Features of the protein sequence

Length: 208 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW69521 2.3e-59 99.4 cold inducible ...
Homo sapiens
XP_868602 9.9e-59 89.6 similar to cold...
Canis lupus fam...
Q14011 4e-58 100.0 Cold-inducible ...
Homo sapiens
AAP36943 4e-58 100.0 cold inducible ...
synthetic construct
BAE88557 7.7e-58 99.4 unnamed protein...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 44 115 PF00076 RNA recognition motif
HMMSmart IPR003954 43 116 SM00361 RNA recognition
IPR000504 43 116 SM00360 RNA recognition motif
ProfileScan IPR000504 42 120 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp