Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10122
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10122
Clone name bm04850
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CPQ
cDNA sequence DNA sequence (1767 bp)
Predicted protein sequence (480 aa)
Flexi ORF Clone FXC10122
Description plasma glutamate carboxypeptidase
Features of the cloned cDNA sequence

Length: 1767 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 317 bp
Genome contig ID gi51511724f_97766271
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAGTAAACACTTAATAAATTTTTGGAAGATCTCTG
Flanking genome sequence
(458635 - 458684)
----+----*----+----*----+----*----+----*----+----*
ATTTTTATGTGTTCATTTATGAACATTAAATACGAAAATATTATGGTTTA

Features of the protein sequence

Length: 480 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y646 1.4e-196 100.0 Plasma glutamat...
Homo sapiens
BAC11423 3.1e-195 99.3 unnamed protein...
Homo sapiens
XP_001146407 2.7e-193 98.9 plasma glutamat...
Pan troglodytes
Q5RDN7 7.9e-191 97.4 Plasma glutamat...
Pongo abelii
XP_001092016 1.7e-190 97.6 similar to plas...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007484 291 369 PF04389 Peptidase M28
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp