ORK10376

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10376

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10376
Clone name	bm01784
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MXRA7
cDNA sequence	DNA sequence (2347 bp) Predicted protein sequence (226 aa)
Description	Matrix-remodeling-associated protein 7 (Transmembrane anchor protein 1)

Features of the cloned cDNA sequence

Description

Length: 2347 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1665 bp
Genome contig ID	gi51511734r_72083604
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTTTTTGTTTGCTGAAATAAAGCTCAATCAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTACCTTAAAAAAAAAGTGGAGCAGTGGCATTTCCATGCCTCATGCTCA

Features of the protein sequence

Description

Length: 226 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P84157	9e-50	100.0	Matrix-remodeli...	Homo sapiens
XP_001153166	2.4e-48	98.0	similar to Tran...	Pan troglodytes
NP_001008529	4e-40	98.8	matrix-remodeli...	Homo sapiens
AAH53983	5.2e-40	98.2	Matrix-remodell...	Homo sapiens
XP_001153221	7.6e-40	97.6	similar to HBV ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	28	ELLAALPALATALALLLAWLLV	49	PRIMARY	22