Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10379
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10379
Clone name bm02151
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol VSTM2L
cDNA sequence DNA sequence (1920 bp)
Predicted protein sequence (275 aa)
Flexi ORF Clone FXC10379
Description V-set and transmembrane domain-containing protein 2-like protein Precursor
Features of the cloned cDNA sequence

Length: 1920 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1090 bp
Genome contig ID gi51511747f_35864952
PolyA signal sequence
(AATAAA,-14)
+----*----+----*----+----*----+----
CTGTGACTACCAGCCAACCTGAATAAAGCGGTTTT
Flanking genome sequence
(142209 - 142258)
----+----*----+----*----+----*----+----*----+----*
AAAAAAACCTCTGGGCAGTGTCTTTCTGGGGCATTTGTGCCTGGGGGGTG

Features of the protein sequence

Length: 275 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001095808 9.9e-81 87.9 similar to stro...
Macaca mulatta
Q96N03 1e-67 100.0 V-set and trans...
Homo sapiens
AAH33818 1.5e-67 99.5 V-set and trans...
Homo sapiens
XP_001928772 5.1e-67 98.5 similar to V-se...
Sus scrofa
AAI05268 5.8e-67 98.0 V-set and trans...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013151 126 215 PF00047 Immunoglobulin
HMMSmart IPR003599 118 235 SM00409 Immunoglobulin subtype
ProfileScan IPR007110 112 229 PS50835 Immunoglobulin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp