ORK10387

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10387

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10387
Clone name	bm05644
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CA11
cDNA sequence	DNA sequence (1521 bp) Predicted protein sequence (385 aa)
HaloTag ORF Clone	FHC10387
Flexi ORF Clone	FXC10387
Description	Carbonic anhydrase-related protein 11 Precursor (CA-RP XI)(CARP XI)(CA-XI)(Carbonic anhydrase-related protein 2)(CARP-2)(CA-RP II)

Features of the cloned cDNA sequence

Description

Length: 1521 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	95 bp
Genome contig ID	gi42406306r_53733093
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- ACCCCTAAAACAAAGCTATTAAAGGGACAGAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTCCTGTTTTCTCAGTGGTCTGATTCTAGGCGCGGTGGGGAAACATTTGG

Features of the protein sequence

Description

Length: 385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75493	4.9e-134	100.0	Carbonic anhydr...	Homo sapiens
AAP88903	4.9e-134	100.0	carbonic anhydr...	synthetic construct
AAC99689	8.7e-134	99.6	carbonic anhydr...	Homo sapiens
Q5R665	2.4e-133	99.3	Carbonic anhydr...	Pongo abelii
BAA36840	3.8e-133	99.3	carbonic anhydr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001148	122	357	PD000865	Carbonic anhydrase
HMMPfam	IPR001148	91	360	PF00194	Carbonic anhydrase
ProfileScan	IPR001148	90	360	PS51144	Carbonic anhydrase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp