Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10390
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10390
Clone name bm06932
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ANAPC5
cDNA sequence DNA sequence (2462 bp)
Predicted protein sequence (759 aa)
Description Anaphase-promoting complex subunit 5 (APC5)(Cyclosome subunit 5)
Features of the cloned cDNA sequence

Length: 2462 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 132 bp
Genome contig ID gi89161190r_120130534
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
CTTGTCAATAAACAGCATTCTGATTAGTTTGTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTGTTGCTAGTAACTACGTATTTGTTTTATTCCCCTTTTCTTCCCTT

Features of the protein sequence

Length: 759 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UJX4 0 99.8 Anaphase-promot...
Homo sapiens
AAF05753 0 99.7 anaphase-promot...
Homo sapiens
XP_001495929 0 98.0 anaphase promot...
Equus caballus
XP_509439 0 98.9 anaphase-promot...
Pan troglodytes
XP_534668 0 97.7 similar to anap...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR013026 305 338 SM00028 Tetratricopeptide region
IPR013026 471 504 SM00028 Tetratricopeptide region
IPR013026 545 578 SM00028 Tetratricopeptide region
IPR013026 585 618 SM00028 Tetratricopeptide region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp