Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10391
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10391
Clone name bm08082
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MOB4
cDNA sequence DNA sequence (2635 bp)
Predicted protein sequence (220 aa)
Description Mps one binder kinase activator-like 3 (Preimplantation protein 3)(Mob1 homolog 3)(Mob3)(Class II mMOB1)(2C4D)
Features of the cloned cDNA sequence

Length: 2635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1972 bp
Genome contig ID gi89161199f_197989071
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
TATGTTTGGAATTGATCATAAAACATCTCCAAAAG
Flanking genome sequence
(136513 - 136562)
----+----*----+----*----+----*----+----*----+----*
AAAATAATCAGTTTGTAGTCTTGCTTTTGTATTCATGTTGATAATCTTAC

Features of the protein sequence

Length: 220 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAP97221 3.2e-101 100.0 2C4D [Homo sapi...
Homo sapiens
Q9QYW3 3.2e-101 100.0 Mps one binder ...
Rattus norvegicus
AAY18863 3.5e-101 100.0 CGI-95 [synthet...
synthetic construct
CAH90246 6.3e-101 99.5 hypothetical pr...
Pongo abelii
BAE28182 1.2e-100 99.5 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005301 35 205 PF03637 Mob1/phocein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp