ORK10392

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10392

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10392
Clone name	bn02131
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	FDX1L
cDNA sequence	DNA sequence (833 bp) Predicted protein sequence (187 aa)
HaloTag ORF Clone	FHC10392
Flexi ORF Clone	FXC10392
Description	Adrenodoxin-like protein, mitochondrial Precursor (Ferredoxin-1-like protein)

Features of the cloned cDNA sequence

Description

Length: 833 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	269 bp
Genome contig ID	gi42406306r_10181893
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ACTCATATTGGAGCTGCAATAAATCGATAACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCCCAGCATGTTGAGTGTCCTTGGGGGACAGATCTGGGGTCTACAGGTG

Features of the protein sequence

Description

Length: 187 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH13303	1.4e-73	99.4	unnamed protein...	Homo sapiens
Q6P4F2	2.3e-72	100.0	Adrenodoxin-lik...	Homo sapiens
XP_512366	3.2e-71	98.9	hypothetical pr...	Pan troglodytes
Q05B51	1.2e-64	88.7	Adrenodoxin-lik...	Bos taurus
XP_542073	1.3e-64	89.6	similar to CG42...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001055	109	119	PR00355	Adrenodoxin
	IPR001055	128	142	PR00355	Adrenodoxin
	IPR001055	151	159	PR00355	Adrenodoxin
HMMPfam	IPR001041	77	161	PF00111	Ferredoxin
ProfileScan	IPR001041	72	174	PS51085	Ferredoxin
ScanRegExp	IPR001055	109	119	PS00814	Adrenodoxin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp