Length: 4139 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
1146 bp |
Genome contig ID |
gi89161199r_130525452 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- GACCATGGATCTGAATAAACATGTCCTTGCTTCTG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AGTCTTCTGGCACCTGGGCTCAGTCTCTAGGAGGTTCACCTGTACAGAGT |
Length: 860 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
NP_060221 |
0 |
100.0 |
sphingomyelin p...
|
Homo sapiens
|
EAW55601 |
0 |
99.7 |
hypothetical pr...
|
Homo sapiens
|
BAA91070 |
0 |
100.0 |
unnamed protein...
|
Homo sapiens
|
XP_001929624 |
0 |
88.3 |
sphingomyelin p...
|
Sus scrofa
|
EDK97472 |
0 |
88.2 |
sphingomyelin p...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
822 |
VASLFCVGPLPCTLLLTLGYVLY |
844 |
PRIMARY |
23 |