Length: 5196 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
203 bp |
| Genome contig ID |
gi51511747f_61710403 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- GCGTCTAAATAAAGCGCCAGCGCAGGATGAAAGCG |
Flanking genome sequence (130499 - 130548) |
----+----*----+----*----+----*----+----*----+----* GCCAGCCTCGCAGCCTGCTCTTCTTGAAAGCTGGGCGGGTTGGGGCGGGG |
Length: 433 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| Q9H400 |
6.2e-109 |
100.0 |
Lck-interacting...
|
Homo sapiens
|
| BAA91148 |
2.1e-108 |
99.6 |
unnamed protein...
|
Homo sapiens
|
| AAP34480 |
5.6e-71 |
100.0 |
LP8067 [Homo sa...
|
Homo sapiens
|
| XP_001113808 |
3e-64 |
76.2 |
similar to zinc...
|
Macaca mulatta
|
| CAI21882 |
3.9e-35 |
100.0 |
novel protein [...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
| Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
28 |
LVTIWAMVATAVLPLLTAVLGVT |
50 |
PRIMARY |
23 |
2 |
148 |
PALWVLGCCALLLSLWALCTAC |
169 |
PRIMARY |
22 |