Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10408
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10408
Clone name fh10640
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol USP47
cDNA sequence DNA sequence (5161 bp)
Predicted protein sequence (166 aa)
Description Ubiquitin carboxyl-terminal hydrolase 47 (EC 3.1.2.15)(Ubiquitin thioesterase 47)(Ubiquitin-specific-processing protease 47)(Deubiquitinating enzyme 47)
Features of the cloned cDNA sequence

Length: 5161 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1389 bp
Genome contig ID gi51511727f_11821056
PolyA signal sequence
(ATTAAA,-31)
+----*----+----*----+----*----+----
AGTCATTAAACTTCTGTGGATGAAGAATCTGGGTT
Flanking genome sequence
(114633 - 114682)
----+----*----+----*----+----*----+----*----+----*
AAGAATAGATTTGTCATCTTTAAATATGACATTTTGTAATGTGTATTGGA

Features of the protein sequence

Length: 166 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH47044 2.4e-64 97.5 USP47 protein [...
Homo sapiens
CAH56337 3.6e-64 97.5 hypothetical pr...
Homo sapiens
BAB84902 3.7e-64 97.5 FLJ00147 protei...
Homo sapiens
EAW68543 4.1e-64 97.5 ubiquitin speci...
Homo sapiens
BAA91348 4.4e-64 96.9 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp