Length: 5161 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
1389 bp |
| Genome contig ID |
gi51511727f_11821056 |
PolyA signal sequence (ATTAAA,-31) |
+----*----+----*----+----*----+---- AGTCATTAAACTTCTGTGGATGAAGAATCTGGGTT |
Flanking genome sequence (114633 - 114682) |
----+----*----+----*----+----*----+----*----+----* AAGAATAGATTTGTCATCTTTAAATATGACATTTTGTAATGTGTATTGGA |
Length: 166 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| AAH47044 |
2.4e-64 |
97.5 |
USP47 protein [...
|
Homo sapiens
|
| CAH56337 |
3.6e-64 |
97.5 |
hypothetical pr...
|
Homo sapiens
|
| BAB84902 |
3.7e-64 |
97.5 |
FLJ00147 protei...
|
Homo sapiens
|
| EAW68543 |
4.1e-64 |
97.5 |
ubiquitin speci...
|
Homo sapiens
|
| BAA91348 |
4.4e-64 |
96.9 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.