ORK10419

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10419

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10419
Clone name	fj05789
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SPIN1
cDNA sequence	DNA sequence (1148 bp) Predicted protein sequence (262 aa)
HaloTag ORF Clone	FHC10419
Flexi ORF Clone	FXC10419
Description	Spindlin-1 (Ovarian cancer-related protein)

Features of the cloned cDNA sequence

Description

Length: 1148 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	113 bp
Genome contig ID	gi89161216f_90093186
PolyA signal sequence (AATGAA,-31)	+--------+--------+----*----+---- GTTTAATGAAAGCTTAAATGTCCCTGCGAACCCAC
Flanking genome sequence (186941 - 186990)	----+--------+--------+--------+--------+----* AATCTCTGCCAGCAGAACTGGTTTTGTTCTGAATAGTACAGATTGATGTG

Features of the protein sequence

Description

Length: 262 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5R997	1.5e-109	100.0	Spindlin-1.	Pongo abelii
AAP36211	1.5e-109	100.0	spindlin [synth...	synthetic construct
Q61142	3.8e-109	99.2	Spindlin-1; 300...	Mus musculus
XP_533554	4.4e-109	99.2	similar to spin...	Canis lupus fam...
Q4V8J7	6.9e-109	98.8	Spindlin-1.	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003671	54	103	PF02513	Spindlin/spermiogenesis-specific protein
	IPR003671	133	182	PF02513	Spindlin/spermiogenesis-specific protein
	IPR003671	214	259	PF02513	Spindlin/spermiogenesis-specific protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp