Length: 5191 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
237 bp |
Genome contig ID |
gi89161210r_39080949 |
PolyA signal sequence (TATAAA,-18) |
+----*----+----*----+----*----+---- GTGGGTCCGACGCAATTTATAAAATTTATGTACTC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAGAAGGGAGACCTGTTTGTTTCATTTCTCATCTGTTTGGGAGATGATTT |
Length: 129 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
CAB66773 |
2.5e-50 |
100.0 |
hypothetical pr...
|
Homo sapiens
|
Q9NPB0 |
2.8e-49 |
100.0 |
Uncharacterized...
|
Homo sapiens
|
EAX03976 |
3.2e-49 |
100.0 |
chromosome 6 op...
|
Homo sapiens
|
XP_001173836 |
7.8e-49 |
99.1 |
similar to chro...
|
Pan troglodytes
|
XP_001117110 |
1.2e-47 |
96.4 |
similar to Prot...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
52 |
VLLWLVLLGLFVELEFGLAYFVL |
74 |
PRIMARY |
23 |