ORK10430

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10430

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10430
Clone name	hj08251
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SLC25A36
cDNA sequence	DNA sequence (4587 bp) Predicted protein sequence (367 aa)
HaloTag ORF Clone	FHC10430
Flexi ORF Clone	FXC10430
Description	Solute carrier family 25 member 36

Features of the cloned cDNA sequence

Description

Length: 4587 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3483 bp
Genome contig ID	gi89161205f_142043419
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- ATTGTTCAAATTTTAAAAATTAAAATACGCTCATG
Flanking genome sequence (138050 - 138099)	----+--------+--------+--------+--------+----* AAAATATGGCTTTTTCTGTAATATATCAACATTTTATTGAGAACATAATC

Features of the protein sequence

Description

Length: 367 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96CQ1	1.2e-125	100.0	Solute carrier ...	Homo sapiens
XP_516786	2.2e-125	99.6	solute carrier ...	Pan troglodytes
EAW79012	1.9e-124	99.6	solute carrier ...	Homo sapiens
BAA91715	7.6e-124	99.3	unnamed protein...	Homo sapiens
XP_587531	1.4e-122	97.1	similar to solu...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002067	65	78	PR00926	Mitochondrial carrier protein
	IPR002067	78	92	PR00926	Mitochondrial carrier protein
	IPR002113	117	138	PR00927	Adenine nucleotide translocator 1
	IPR002030	127	144	PR00784	Mitochondrial brown fat uncoupling protein
	IPR002067	139	159	PR00926	Mitochondrial carrier protein
	IPR002030	169	187	PR00784	Mitochondrial brown fat uncoupling protein
	IPR002067	187	205	PR00926	Mitochondrial carrier protein
	IPR002113	211	232	PR00927	Adenine nucleotide translocator 1
	IPR002067	240	258	PR00926	Mitochondrial carrier protein
	IPR002030	248	269	PR00784	Mitochondrial brown fat uncoupling protein
	IPR002067	289	311	PR00926	Mitochondrial carrier protein
	IPR002113	331	346	PR00927	Adenine nucleotide translocator 1
HMMPfam	IPR001993	61	169	PF00153	Mitochondrial substrate carrier
	IPR001993	173	264	PF00153	Mitochondrial substrate carrier
	IPR001993	281	367	PF00153	Mitochondrial substrate carrier
ProfileScan	IPR001993	60	164	PS50920	Mitochondrial substrate carrier
	IPR001993	172	259	PS50920	Mitochondrial substrate carrier
	IPR001993	280	364	PS50920	Mitochondrial substrate carrier

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp