Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10432
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10432
Clone name pf02676
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CNOT1
cDNA sequence DNA sequence (7628 bp)
Predicted protein sequence (2385 aa)
Description CCR4-NOT transcription complex subunit 1 (Negative regulator of transcription subunit 1 homolog)(NOT1H)(hNOT1)(CCR4-associated factor 1)
Features of the cloned cDNA sequence

Length: 7628 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 259 bp
Genome contig ID gi51511732r_57012104
PolyA signal sequence
(AATACA,-14)
+----*----+----*----+----*----+----
ATATCATTTTGAACTTGTGTAAATACATGAAAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACCTTTGTCTGGAACTTCTTGGCTTTGTGCAAGCTGTGTCCAAGGCA

Features of the protein sequence

Length: 2385 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
ABQ66268 0 99.9 CNOT1 [Homo sap...
Homo sapiens
A5YKK6 0 99.7 CCR4-NOT transc...
Homo sapiens
XP_001153220 0 99.6 CCR4-NOT transc...
Pan troglodytes
XP_613555 0 99.4 CCR4-NOT transc...
Bos taurus
XP_001495291 0 99.5 CCR4-NOT transc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007196 2005 2385 PF04054 CCR4-Not complex component
ScanRegExp IPR001220 2263 2269 PS00307 Legume lectin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp