ORK10441

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10441

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10441
Clone name	sh07176
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GNB2
cDNA sequence	DNA sequence (1149 bp) Predicted protein sequence (340 aa)
HaloTag ORF Clone	FHC10441
Flexi ORF Clone	FXC10441
Description	Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2 (Transducin beta chain 2)(G protein subunit beta-2)

Features of the cloned cDNA sequence

Description

Length: 1149 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	124 bp
Genome contig ID	gi89161213f_100011823
PolyA signal sequence (None)	+--------+--------+----*----+---- CCCCTTCCCCGGGCCACGGGGCCTTGGGTCCCTGC
Flanking genome sequence (102663 - 102712)	----+--------+--------+--------+--------+----* CCTCCCACCCAGGTTTGGTTCCTCCCGGGGCCCCCACTGTGGAGATAAGA

Features of the protein sequence

Description

Length: 340 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P62879	9.4e-148	100.0	Guanine nucleot...	Homo sapiens
BAE89269	2.4e-147	99.7	unnamed protein...	Macaca fascicularis
AAC72250	3.8e-147	99.4	G protein beta ...	Mus musculus
XP_001366905	3.8e-147	99.4	similar to cell...	Monodelphis dom...
AAA35922	1.5e-146	99.4	G protein beta ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	50	84	PD000018	WD40 repeat
	IPR001680	139	171	PD000018	WD40 repeat
	IPR001680	180	213	PD000018	WD40 repeat
	IPR001680	221	255	PD000018	WD40 repeat
	IPR001680	307	340	PD000018	WD40 repeat
FPrintScan	IPR001632	51	67	PR00319	G-protein
	IPR001632	70	84	PR00319	G-protein
	IPR001680	70	84	PR00320	WD40 repeat
	IPR001632	89	104	PR00319	G-protein
	IPR001632	107	124	PR00319	G-protein
	IPR001680	157	171	PR00320	WD40 repeat
	IPR001680	199	213	PR00320	WD40 repeat
HMMPfam	IPR001680	45	83	PF00400	WD40 repeat
	IPR001680	87	125	PF00400	WD40 repeat
	IPR001680	133	170	PF00400	WD40 repeat
	IPR001680	174	212	PF00400	WD40 repeat
	IPR001680	216	254	PF00400	WD40 repeat
	IPR001680	272	298	PF00400	WD40 repeat
	IPR001680	302	340	PF00400	WD40 repeat
HMMSmart	IPR001680	44	83	SM00320	WD40 repeat
	IPR001680	86	125	SM00320	WD40 repeat
	IPR001680	132	170	SM00320	WD40 repeat
	IPR001680	173	212	SM00320	WD40 repeat
	IPR001680	215	254	SM00320	WD40 repeat
	IPR001680	257	298	SM00320	WD40 repeat
	IPR001680	301	340	SM00320	WD40 repeat
ProfileScan	IPR001680	51	92	PS50082	WD40 repeat
	IPR001680	51	340	PS50294	WD40 repeat
	IPR001680	139	179	PS50082	WD40 repeat
	IPR001680	180	221	PS50082	WD40 repeat
	IPR001680	222	263	PS50082	WD40 repeat
	IPR001680	273	307	PS50082	WD40 repeat
	IPR001680	308	340	PS50082	WD40 repeat
ScanRegExp	IPR001680	70	84	PS00678	WD40 repeat
	IPR001680	157	171	PS00678	WD40 repeat
	IPR001680	285	299	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp