ORK10472

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10472

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10472
Clone name	fk16294
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COPG1
cDNA sequence	DNA sequence (3046 bp) Predicted protein sequence (898 aa)
HaloTag ORF Clone	FHC10472
Flexi ORF Clone	FXC10472
Description	coatomer protein complex, subunit gamma

Features of the cloned cDNA sequence

Description

Length: 3046 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	348 bp
Genome contig ID	gi89161205f_130351170
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCTTATCCCTGTAATAAATCAGCATGTATTTATTG
Flanking genome sequence (128136 - 128185)	----+--------+--------+--------+--------+----* AATGATTGCTACTTCTGCAGACTCATGCTTCAGGGCTCCACCTTCCCCTT

Features of the protein sequence

Description

Length: 898 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y678	100.0	Coatomer subuni...	Homo sapiens
BAF84382	99.8	unnamed protein...	Homo sapiens
XP_001141317	99.7	coatomer protei...	Pan troglodytes
BAG50968	99.5	unnamed protein...	Homo sapiens
XP_001488579	98.8	coatomer protei...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002553	47	563	PF01602	Clathrin/coatomer adaptor
HMMPfam	IPR014863	633	898	PF08752	Coatomer

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp