Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10475
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10475
Clone name ef04257
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HSPA5
cDNA sequence DNA sequence (2516 bp)
Predicted protein sequence (716 aa)
Flexi ORF Clone FXC10475
Description heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Features of the cloned cDNA sequence

Length: 2516 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 346 bp
Genome contig ID gi89161216r_126938346
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACCATAAGTGACACCAATAAATGTTTGTTATTTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGGTCTAATGTTTGTGAGAAGCTTCTAATTAGATCAATTACTTATTTT

Features of the protein sequence

Length: 716 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P11021 0 100.0 78 kDa glucose-...
Homo sapiens
Q5R4P0 0 99.6 78 kDa glucose-...
Pongo abelii
BAE79724 0 99.6 immunoglobulin ...
Macaca fuscata
Q3S4T7 0 99.0 78 kDa glucose-...
Spermophilus tr...
P07823 0 98.7 78 kDa glucose-...
Mesocricetus au...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013126 161 254 PD000089 Heat shock protein 70
FPrintScan IPR001023 91 104 PR00301 Heat shock protein Hsp70
IPR001023 119 131 PR00301 Heat shock protein Hsp70
IPR001023 142 150 PR00301 Heat shock protein Hsp70
IPR001023 230 250 PR00301 Heat shock protein Hsp70
IPR001023 290 300 PR00301 Heat shock protein Hsp70
IPR001023 418 434 PR00301 Heat shock protein Hsp70
IPR001023 450 470 PR00301 Heat shock protein Hsp70
IPR001023 475 494 PR00301 Heat shock protein Hsp70
IPR001023 556 572 PR00301 Heat shock protein Hsp70
HMMPfam IPR013126 92 698 PF00012 Heat shock protein 70
ScanRegExp IPR013126 95 102 PS00297 Heat shock protein 70
IPR013126 284 297 PS00329 Heat shock protein 70
IPR013126 421 435 PS01036 Heat shock protein 70
IPR000886 713 716 PS00014 Endoplasmic reticulum targeting sequence
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp