Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10476
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10476
Clone name eg00017
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol EEF2K
cDNA sequence DNA sequence (7350 bp)
Predicted protein sequence (731 aa)
Flexi ORF Clone FXC10476
Description eukaryotic elongation factor-2 kinase
Features of the cloned cDNA sequence

Length: 7350 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4741 bp
Genome contig ID gi51511732f_22025147
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TCTCTTTACAAATAAAGTGTTTTCTTTCTTTTCTG
Flanking genome sequence None

Features of the protein sequence

Length: 731 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O00418 0 100.0 Eukaroytic elon...
Homo sapiens
AAH32665 0 99.8 EEF2K protein [...
Homo sapiens
AAX41017 0 99.8 elongation fact...
synthetic construct
XP_001161085 0 99.0 elongation fact...
Pan troglodytes
XP_001092565 0 97.6 elongation fact...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004166 126 324 PF02816 MHCK/EF2 kinase
IPR006597 596 615 PF08238 Sel1-like
IPR006597 668 707 PF08238 Sel1-like
HMMSmart IPR004166 127 324 SM00811 MHCK/EF2 kinase
ProfileScan IPR004166 122 332 PS51158 MHCK/EF2 kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp