ORK10477

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10477

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10477
Clone name	fk05082
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	WFIKKN2
cDNA sequence	DNA sequence (3251 bp) Predicted protein sequence (600 aa)
HaloTag ORF Clone	FHC10477
Flexi ORF Clone	FXC10477
Description	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2

Features of the cloned cDNA sequence

Description

Length: 3251 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1327 bp
Genome contig ID	gi51511734f_46168183
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- AAGGAGGAAGATACCAATTAAAAGCTCATAGTATC
Flanking genome sequence (106525 - 106574)	----+--------+--------+--------+--------+----* AACTGCCCTTCTTGTGTGATTCGTTTGGGTTATGATGGGGGAGGGAGGGA

Features of the protein sequence

Description

Length: 600 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TEU8	100.0	WAP, kazal, imm...	Homo sapiens
BAG35678	99.8	unnamed protein...	Homo sapiens
AAQ88509	99.8	Bikunin hlg [Ho...	Homo sapiens
XP_001100200	98.4	similar to WFIK...	Macaca mulatta
XP_548206	93.7	similar to WFIK...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002223	352	403	PD000222	Proteinase inhibitor I2
BlastProDom	IPR002223	410	460	PD000222	Proteinase inhibitor I2
FPrintScan	IPR015874	63	72	PR00003	4-disulphide core
	IPR015874	89	96	PR00003	4-disulphide core
	IPR015874	96	105	PR00003	4-disulphide core
	IPR002223	407	421	PR00759	Proteinase inhibitor I2
	IPR002223	435	445	PR00759	Proteinase inhibitor I2
	IPR002223	445	460	PR00759	Proteinase inhibitor I2
	IPR015874	455	463	PR00003	4-disulphide core
HMMPfam	IPR008197	66	115	PF00095	Whey acidic protein
	IPR011497	157	191	PF07648	Protease inhibitor
	IPR013098	234	328	PF07679	Immunoglobulin I-set
	IPR002223	351	403	PF00014	Proteinase inhibitor I2
	IPR002223	409	461	PF00014	Proteinase inhibitor I2
HMMSmart	IPR008197	66	116	SM00217	Whey acidic protein
	IPR003599	240	329	SM00409	Immunoglobulin subtype
	IPR003598	246	318	SM00408	Immunoglobulin subtype 2
	IPR002223	350	403	SM00131	Proteinase inhibitor I2
	IPR002223	408	461	SM00131	Proteinase inhibitor I2
ProfileScan	IPR007110	234	327	PS50835	Immunoglobulin-like
	IPR002223	352	402	PS50279	Proteinase inhibitor I2
	IPR002223	410	460	PS50279	Proteinase inhibitor I2
	IPR001134	469	590	PS50189	Netrin
ScanRegExp	IPR008197	90	103	PS00317	Whey acidic protein
ScanRegExp	IPR002223	438	456	PS00280	Proteinase inhibitor I2

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp