ORK10492

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10492

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10492
Clone name	fk00565
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fk00565 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	GPC3
cDNA sequence	DNA sequence (2245 bp) Predicted protein sequence (616 aa)
HaloTag ORF Clone	FHC10492
Flexi ORF Clone	FXC10492
Description	glypican 3

Features of the cloned cDNA sequence

Description

Length: 2245 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	374 bp
Genome contig ID	gi89161218r_132397466
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATGGATTTCTTTGAAAAAAAATAAATTGCTCAAAT
Flanking genome sequence (99978 - 99929)	----+--------+--------+--------+--------+----* AAAAATGTATTGGCCCTTTTTTTGCAAACCGTCGTCTATGGTGACTGCGC

Features of the protein sequence

Description

Length: 616 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P51654	100.0	Glypican-3; Int...	Homo sapiens
BAD96481	99.8	glypican 3 vari...	Homo sapiens
AAH35972	99.8	Glypican 3 [Hom...	Homo sapiens
AAX36128	99.8	glypican 3 [syn...	synthetic construct
XP_001097558	99.3	glypican 3 isof...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001863	46	614	PF01153	Glypican
ScanRegExp	IPR001863	298	321	PS01207	Glypican

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp