Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10505
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10505
Clone name bm04749
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol LGALS3BP
cDNA sequence DNA sequence (2216 bp)
Predicted protein sequence (629 aa)
Flexi ORF Clone FXC10505
Description lectin, galactoside-binding, soluble, 3 binding protein
Features of the cloned cDNA sequence

Length: 2216 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 320 bp
Genome contig ID gi51511734r_74378933
PolyA signal sequence
(ATTAAA,-23)		 
+----*----+----*----+----*----+----
TGGTCTGAGGTCATTAAAATTACATTGAGGTTCCT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACATTTGTTTGTACAGAAAGTGTTGTTGGGTCCACACCGTGTTTAGACAT

Features of the protein sequence

Length: 629 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q08380 0 100.0 Galectin-3-bind...
 Homo sapiens
ABM86350 0 99.8 lectin, galacto...
 synthetic construct
Q5RDA4 0 99.4 Galectin-3-bind...
 Pongo abelii
XP_511716 0 98.8 galectin 3 bind...
 Pan troglodytes
EAW89543 0 100.0 lectin, galacto...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001190 68 84 PR00258 Speract/scavenger receptor
IPR001190 87 98 PR00258 Speract/scavenger receptor
IPR001190 102 112 PR00258 Speract/scavenger receptor
IPR001190 133 147 PR00258 Speract/scavenger receptor
IPR001190 156 168 PR00258 Speract/scavenger receptor
HMMPfam IPR001190 71 168 PF00530 Speract/scavenger receptor
IPR011705 304 404 PF07707 BTB/Kelch-associated
HMMSmart IPR001190 68 168 SM00202 Speract/scavenger receptor
ProfileScan IPR001190 68 168 PS50287 Speract/scavenger receptor
IPR000210 197 265 PS50097 BTB/POZ-like
ScanRegExp IPR001190 73 110 PS00420 Speract/scavenger receptor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp