Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10509
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10509
Clone name bm03295
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HSPA8
cDNA sequence DNA sequence (2285 bp)
Predicted protein sequence (680 aa)
Flexi ORF Clone FXC10509
Description heat shock 70kDa protein 8
Features of the cloned cDNA sequence

Length: 2285 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 241 bp
Genome contig ID gi51511727r_122333411
PolyA signal sequence
(AATAAA,-27)		 
+----*----+----*----+----*----+----
ATGTCTTAAATAAAACTATTTAAAATTGGCACCAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACAATTGCTTTGAGTCTTTAAATAATCTCCCAGGCCAGCTGGTGGGAGAA

Features of the protein sequence

Length: 680 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P11142 0 100.0 Heat shock cogn...
 Homo sapiens
BAD96505 0 99.8 heat shock 70kD...
 Homo sapiens
Q5NVM9 0 99.8 Heat shock cogn...
 Pongo abelii
P63018 0 99.8 Heat shock cogn...
 Rattus norvegicus
BAE41082 0 99.6 unnamed protein...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR013126 108 200 PD000089 Heat shock protein 70
FPrintScan IPR001023 39 52 PR00301 Heat shock protein Hsp70
IPR001023 67 79 PR00301 Heat shock protein Hsp70
IPR001023 89 97 PR00301 Heat shock protein Hsp70
IPR001023 176 196 PR00301 Heat shock protein Hsp70
IPR001023 237 247 PR00301 Heat shock protein Hsp70
IPR001023 365 381 PR00301 Heat shock protein Hsp70
IPR001023 397 417 PR00301 Heat shock protein Hsp70
IPR001023 424 443 PR00301 Heat shock protein Hsp70
IPR001023 505 521 PR00301 Heat shock protein Hsp70
HMMPfam IPR013126 40 646 PF00012 Heat shock protein 70
ScanRegExp IPR013126 43 50 PS00297 Heat shock protein 70
IPR013126 231 244 PS00329 Heat shock protein 70
IPR013126 368 382 PS01036 Heat shock protein 70
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp