ORK10528

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10528

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10528
Clone name	bm03021
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	P2RX5
cDNA sequence	DNA sequence (1899 bp) Predicted protein sequence (419 aa)
HaloTag ORF Clone	FHC10528
Flexi ORF Clone	FXC10528
Description	purinergic receptor P2X, ligand-gated ion channel, 5

Features of the cloned cDNA sequence

Description

Length: 1899 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	638 bp
Genome contig ID	gi51511734r_3423273
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTTGGTCATAAAACAATAAATGGTGTCAATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACGTGTCCTGATTTTTTTCTCTTCATGTTTACCCATCTTTTTTTTTGA

Features of the protein sequence

Description

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q93086	1.7e-187	100.0	P2X purinocepto...	Homo sapiens
XP_511272	1.1e-186	99.5	purinergic rece...	Pan troglodytes
AAC51931	4.8e-186	98.8	ATP receptor su...	Homo sapiens
XP_001158689	3.8e-185	99.0	similar to P2X ...	Pan troglodytes
XP_001158503	1.9e-184	99.0	similar to P2X ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003048	55	65	PR01312	P2X5 purinoceptor
	IPR001429	81	89	PR01307	P2X purinoreceptor
	IPR003048	116	125	PR01312	P2X5 purinoceptor
	IPR001429	158	169	PR01307	P2X purinoreceptor
	IPR001429	242	254	PR01307	P2X purinoreceptor
	IPR001429	288	298	PR01307	P2X purinoreceptor
	IPR001429	308	322	PR01307	P2X purinoreceptor
	IPR003048	336	344	PR01312	P2X5 purinoceptor
HMMPfam	IPR001429	11	361	PF00864	P2X purinoreceptor
HMMTigr	IPR001429	1	348	TIGR00863	P2X purinoreceptor
ScanRegExp	IPR001429	249	275	PS01212	P2X purinoreceptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	27	GLLYRLLQASILAYLVVWVFLI	48	PRIMARY	22