ORK11054

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11054

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11054
Clone name	bm02540
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HADH
cDNA sequence	DNA sequence (1826 bp) Predicted protein sequence (339 aa)
HaloTag ORF Clone	FHC11054
Flexi ORF Clone	FXC11054
Description	hydroxyacyl-Coenzyme A dehydrogenase

Features of the cloned cDNA sequence

Description

Length: 1826 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	806 bp
Genome contig ID	gi89161207f_109030463
PolyA signal sequence (AGTAAA,-18)	+--------+--------+----*----+---- ACTCAAATGATTATAAAAGTAAAAGTTGGTAATTT
Flanking genome sequence (145307 - 145356)	----+--------+--------+--------+--------+----* AGGCAGAAGCTATTTCTCCTCTTCTTTGACCTGCTGTTAATTTTTAAAGT

Features of the protein sequence

Description

Length: 339 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06219	2e-130	100.0	L-3-hydroxyacyl...	Homo sapiens
Q16836	4.8e-118	100.0	Hydroxyacyl-coe...	Homo sapiens
CAA65528	1.1e-117	99.6	3-hydroxyacyl-C...	Homo sapiens
BAG37053	1.8e-117	99.6	unnamed protein...	Homo sapiens
NP_005318	3.7e-117	99.6	hydroxyacyl-coe...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006176	52	239	PF02737	3-hydroxyacyl-CoA dehydrogenase
HMMPfam	IPR006108	241	338	PF00725	3-hydroxyacyl-CoA dehydrogenase
ScanRegExp	IPR006180	238	262	PS00067	3-hydroxyacyl-CoA dehydrogenase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp