ORK11478

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11478

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11478
Clone name	hj08059
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HYAL3
cDNA sequence	DNA sequence (4574 bp) Predicted protein sequence (431 aa)
HaloTag ORF Clone	FHC11478
Flexi ORF Clone	FXC11478
Description	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)

Features of the cloned cDNA sequence

Description

Length: 4574 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3160 bp
Genome contig ID	gi89161205r_50200169
PolyA signal sequence (ATTAAA,-32)	+--------+--------+----*----+---- ATAATTAAACAGAACGGTCAGCCTTCTGTGGTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCCTGGGTATTTTTCTGTTCTCCCTCCCCATCTACTATCCCAGGCTT

Features of the protein sequence

Description

Length: 431 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O43820	1.4e-190	100.0	Hyaluronidase-3...	Homo sapiens
AAH05896	2.5e-190	99.7	Hyaluronoglucos...	Homo sapiens
AAX29543	2.5e-190	99.7	hyaluronoglucos...	synthetic construct
AAH12892	4.6e-190	99.7	Hyaluronoglucos...	Homo sapiens
XP_516476	8.5e-190	99.2	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001968	70	360	PD003549	Glycoside hydrolase
FPrintScan	IPR001968	45	57	PR00846	Glycoside hydrolase
	IPR001968	105	119	PR00846	Glycoside hydrolase
	IPR001968	136	153	PR00846	Glycoside hydrolase
	IPR001968	194	219	PR00846	Glycoside hydrolase
	IPR001968	242	256	PR00846	Glycoside hydrolase
	IPR001968	345	358	PR00846	Glycoside hydrolase
HMMPfam	IPR001968	35	368	PF01630	Glycoside hydrolase
ScanRegExp	IPR013032	409	420	PS00022	EGF-like region
ScanRegExp	IPR013032	409	420	PS01186	EGF-like region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp