Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11485
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11485
Clone name fg04316
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FECH
cDNA sequence DNA sequence (7246 bp)
Predicted protein sequence (455 aa)
Flexi ORF Clone FXC11485
Description ferrochelatase (protoporphyria)
Features of the cloned cDNA sequence

Length: 7246 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5878 bp
Genome contig ID gi51511735r_53263072
PolyA signal sequence
(ATTAAA,-29)
+----*----+----*----+----*----+----
AGTTATATTAAAAACAAAGGTAACATTCTAAATTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTACTTTCTAATTATTTCGCCCTTTTTTTTGTCGTTGATTATTTAGACT

Features of the protein sequence

Length: 455 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P22830 6.5e-176 100.0 Ferrochelatase,...
Homo sapiens
BAA00628 1.6e-175 99.7 ferrochelatase ...
Homo sapiens
EAW63047 1.7e-174 98.6 ferrochelatase ...
Homo sapiens
BAD96910 2.2e-174 99.7 Hypothetical pr...
Homo sapiens
AAV38762 4.7e-174 99.5 ferrochelatase ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001015 105 455 PD002792 Ferrochelatase
HMMPfam IPR001015 100 421 PF00762 Ferrochelatase
HMMTigr IPR001015 96 422 TIGR00109 Ferrochelatase
ScanRegExp IPR001015 290 308 PS00534 Ferrochelatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp